Council archive · source document
Traffic Engineering Report · MCU23/0096
Very large file (11.7 MB): the original may take a few minutes to open or download. The page text below is quick to read.
19915
V02
March 2023
Traffic Engineering Report
Review of Access and Parking
Comparative Analysis of Survey Data
Good Shepherd Lutheran College
115 Eumundi Road, Noosaville
For
Good Shepherd Lutheran College
See the original
The page text is free to read. Viewing or downloading an original file needs an account.
Log in to see the originalFull text of the other 42 pages
Page 2
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Good Shepherd Lutheran College
115 Eumundi Road, Noosaville
Lot 1 SP228052 and Lot 30 SP170751
Project Date Issue Dianne Hayes RPEQ 7086
19915 July 2022 DRAFT
19915 October 2022 V01
19915 March 2023 V02
Project No: 19915
March 2023
Status: DA Issue no: V02
Hayes Traffic Engineering
ABN: 98 615 073 565
PO Box 303
Coolum Beach Qld 4573
Phone: 0403 889 039
[email protected]
Dianne Hayes
RPEQ 7086
(c) Copyright Hayes Traffic Engineering.
This report has been prepared for the exclusive use of the commissioning party and unless otherwise agreed in
writing by Hayes Traffic Engineering, no other party may copy, reproduce, distribute, make use of, or reply on the
contents of the report. No liability is accepted by Hayes Traffic Engineering for any use of this report, other than
for the purposes for which it was originally prepared and provided.
Page 2
Page 3
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
TABLE OF CONTENTS
1 INTRODUCTION ............................................................................................... 4
2 EXISTING CONDITIONS .................................................................................... 5
3 MASTER PLAN ................................................................................................. 6
4 SURVEY AREAS ................................................................................................ 7
5 PARKING & ACCESS ANALYSIS ......................................................................... 9
5.1 Access Traffic Flows....................................................................................... 9
5.2 Vehicle Queues.............................................................................................. 9
5.3 Parking Demand .......................................................................................... 10
6 CAR PARKING DEMAND................................................................................. 15
6.1 Compliance with Council & TMR Requirements ......................................... 15
6.2 Improvement to drop‐off and pick‐up arrangements ................................ 17
7 NETWORK PERFORMANCE ............................................................................ 20
7.1 Goodchap Street and Eumundi Road .......................................................... 20
7.2 Eumundi Road & Walter Hay Drive............................................................. 24
7.3 Walter Hay Drive & Eenie Creek Road ........................................................ 27
7.4 Summary of Network Conditions................................................................ 30
8 CONCLUSIONS & RECOMMENDATIONS ......................................................... 31
Appendices
Appendix A – Traffic Survey Data (Provided by Austraffic)
Appendix B – Master Plan
Page 3
Page 4
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
1 INTRODUCTION
Hayes Traffic Engineering has been commissioned by Good Shepherd Lutheran College
(GSLC) to provide traffic engineering advice for the college.
This report has been produced to review the changes to access and parking demand
since the construction of the new staff car park on the corner of Eumundi Noosa Road
and Walter Hay Drive. A review of the road network has also been carried out to
determine the operational performance of the three roundabouts during the school
morning and afternoon peak hours.
The objective of this study is to provide information to the College relating to safe and
efficient access, parking and traffic behaviours. This information is to be used to assist
the College and other parties understand whether traffic flow is being adequately
serviced under the current arrangement and what impact further changes are likely to
have.
Figure 1 ‐ Aerial view of subject site
Source: Qld Globe
Page 4
Page 5
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
2 EXISTING CONDITIONS
The College currently has an all movement access from the Eumundi Road and
Goodchap Street roundabout. This provides access to the drop off and pick up zone
and parent short and long term parking area.
There is also access from Walter Hay Drive with left‐turn only entry and left turn out
exit. This area provides access to the long term staff car park (which is controlled by
boom gate access), the bus pick‐up area as well as a long term visitor and student car
parking area. Please refer to Figure 2 for access locations and car parking areas.
Figure 2 – 2022 Access to the College from Eumundi Road and Walter Hay Drive
Source: Near Map
Page 5
Page 6
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
3 MASTER PLAN
The proposed master plan is shown in Figure 3. Building B and associated pre‐perp
car parking was completed in 2021 and the new secure staff car park on the corner of
Eumundi Noosa Road and Walter Hay Drive was also completed in 2021. The master
plan includes a new performing arts building, which will be built in place of the old
staff car parking area (refer to blue building 1). The plans also include changes to the
short term car park to improve traffic flow and pedestrian safety and provide a longer
drop‐off and pick‐up lane for students.
Figure 3 – Proposed Master Plan
Source: Burling Brown
Page 6
Page 7
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
4 SURVEY AREAS
In order to assess the impacts of improvements to access and parking as part of staged
works associated with the master plan, parking surveys and intersection surveys were
carried out.
Traffic surveys were carried out on Tuesday 3rd March 2020 to determine the entering
and exiting traffic flows at four locations, the queueing from the drop off/pick up area
and the car parking occupancy within the car parking areas. Survey was carried out
between 7:30am and 4:30pm. Figure 4 indicates the areas which were surveyed.
The second survey were undertaken on Tuesday 3rd May 2022 to determine changes
to traffic flows and parking demand as a result of the new staff car park and
improvements and extension of the pick up and drop off area. Figure 5 indicates the
new staff car park and the extension to the existing drop off and pick up zone. Please
refer to Appendix B for detailed survey data for all surveyed areas.
Figure 4 – Surveyed Areas 2020
Source: Near Map
Page 7
Page 8
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Figure 5 – Changed Areas for 2022 Surveys
New Staff
Car Park
Extended
Pick Up
Zone
Source: Near Map
Page 8
Page 9
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
5 PARKING & ACCESS ANALYSIS
A comparison between the 2020 and 2022 survey data has been undertaken to
determine the impact of changes to car parking areas and improvement to the drop
off and pick up zone.
5.1 Access Traffic Flows
The recorded traffic flows indicated the peak period generally occurred at 8:30am and
3:00pm which aligns with the school start and end times. The number of vehicles
entering and exiting at each location is provided in Table 1 and 2. There was a
reduction in the number of bus movements throughout the survey period with 27
buses entering and 24 exiting recorded throughout the day in 2020 and 25 buses
entering and 22 existing in 2022.
Table 1 – Entry and Exit Flows 2020
Location AM Peak Hour PM Peak Hour
Entering Exiting Entering Exiting
Eumundi Road Roundabout 318 263 158 193
Walter Hay Drive 141 109 100 98
Eumundi Road 47 38 65 76
(Temporary Car Park Access)
Table 2 – Entry and Exit Flows 2022
Location AM Peak Hour PM Peak Hour
Entering Exiting Entering Exiting
Eumundi Road Roundabout 287 282 145 186
Walter Hay Drive 192 110 86 141
As expected, there was an increase in movements to and from Walter Hay Drive due
to the changes in accessing parking areas. There was a decrease in vehicles entering
from Eumundi Road and a slight increase in vehicles exiting in the morning peak.
This may suggest more families are dropping off in the morning peak period rather
than parking and exiting later.
5.2 Vehicle Queues
Vehicle queuing from Eumundi Road was recorded to determine if and when the
impact of vehicle waiting in the drop‐off and pick up area extended to the Eumundi
Road roundabout. In 2020 there was provision for 8 vehicles in the designated drop
Page 9
Page 10
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
off and pick up zone with queuing for a further 8 vehicles within the site. While
temporary, the queueing area increased significantly in 2022 with changes to the drop
off and pick up area due to the removal of the Area C. The proposed final configuration
of this area will provide for up to 16 vehicles in the designated drop off and pick up
zone and 6 queued vehicles.
Table 3 – Vehicle Queues (Eumundi Road Access) AM and PM Peak Periods
Time Interval No. of Vehicles Queued No. of Vehicles Queued
2020 2022
8:00 – 8:15 am 4 0
AM 8:15 – 8:30 am 10 7
8:30 – 8:45 am 1 0
2:45 – 3:00 pm 9 0
PM 3:00 – 3:15 pm 11 8
3:15 – 3:30 pm 1 0
As shown in Table 3 the number of vehicles queued has significantly decreased,
mitigating any potential impact to the Eumundi Road/Goodchap Street roundabout.
5.3 Parking Demand
Parking occupancy surveys were carried out to determine the parking demand at the
college. Survey areas are shown in Figure 3. Occupancy was recorded every 10
minutes between 7:30am and 9:00am and also between 2:30am and 4:00pm with
surveys between 9:00am and 2:30pm and 4:00pm and 4:30pm recorded in 15 minute
intervals. A summary of the peak demand for parking across all zones in provided in
Table 4 for 2020 surveys and Table 5 for 2022 surveys.
Please note the Pre‐prep area provides parking for childcare and has approval under
separate conditions and therefore has been excluded from the results.
Table 4 – Car Parking Demand Survey Results 2020
Parking Available @ 8:30 AM Peak @ 3:00 PM Peak
Zone Spaces Spaces Utilisation Spaces Utilisation
Area Occupied % Occupied %
A 15 15 100% 14 93%
B 43 31 72% 44 102%
C 94 79 84% 79 84%
D 51 22 43% 24 47%
E No formal spaces 49 81
TOTAL 203 196 242
(excludes 2 motorcycle bays,
drop off zone)
# where utilization exceed 100%, cars were standing illegally or waiting in aisles
Page 10
Page 11
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Table 5 – Car Parking Demand Survey Results 2022
Parking Available @ 8:30 AM Peak @ 3:00 PM Peak
Zone Spaces Spaces Utilisation Spaces Utilisation
Area Occupied % Occupied %
A 15 10 67% 12 80%
B 42 21 50% 48 114%
C 0 (Area Removed) 0 0
D 47 30 64% 49 104%
E 153 134 88% 132 86%
TOTAL 255 195 241
(excludes 2 motorcycle bays,
drop off zone)
# where utilization exceed 100%, cars were standing illegally or waiting in aisles
Results indicate that the overall car parking demand is very similar in 2020 and 2022,
with consistent demand for the College.
A summary of parking demand on the College for all Areas (excluding Pre‐prep) is
provided in Figure 6 and clearly shows the peak demand occurring at 8:30am and
3:00pm in both 2020 and 2022. Whilst there is no change to the peak demand. Survey
data suggests there are more vehicles parked on site in 2022, which is due to the
additional number of secure staff parking spaces available in the new car park.
Figure 6 – Parking Occupancy for all Parking Areas (Excluding Pre‐Prep)
Car Parking Occupancy
300
250
Number of Cars Parked
200
150
100
50
0
Time of Day
Series2 Series3
Page 11
Page 12
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
The parking demand has also been assessed based on the management of parking
areas within the College. Figure 7 and 8 indicates the parking occupancy within the
secure staff car park (Area C in 2020 and Area E in 2022) throughout the school day.
As expected, the results indicate that staff arrive prior to 8:30am and depart after
3:30pm with little fluctuation in parking demand throughout the day. The data
indicates the pattern between 2020 and 2022 is similar providing confidence in survey
results.
Whilst the secure staff car park (Area E) is available to staff for all day parking, it was
not 100% occupied. There are 153 available spaces and the peak occurred at 9:45am
with 138 spaces occupied and 15 spaces available.
Figure 7 – Parking Occupancy for Secure Staff Parking Area 2020
Car Parking Area C (Staff) 2020
90
80
70
60
50
40
30
20
10
0
Page 12
Page 13
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Figure 8 – Parking Occupancy for Secure Staff Parking Area 2022
Car Parking Area E Occupancy (Staff) 2022
160
140
120
Number of Spaces
100
80
60
40
20
0
Time of Day
Areas A and B were also reviewed to determine any changes to parking behaviour
patterns. Results indicate there is less parking in these area throughout the day in
2022 compared to 2020, indicating staff were previously parking all day in these
areas.
Figure 9 ‐ Parking Survey Areas A and B
Page 13
Page 14
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Figure 10 – Parking Occupancy for Area A and B in 2020 and 2022
Area A and B Occupancy
50
45
40
Number of Spaces
35
30
25
20
15
10
5
0
Time of Day
A 2020 B 2020 A 2022 B 2022
Page 14
Page 15
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
6 CAR PARKING DEMAND
An assessment on the car parking availability, car parking demand and impacts of
changes to car parking has been undertaken with a view to achieve compliance with
current standards.
The number of students at the college is not projected to exceed 1140 students plus
54 children in the pre‐prep (childcare) as part of education for the early years. The
equivalent full time staff for the school is currently 130.
6.1 Compliance with Council & TMR Requirements
An assessment of the required parking spaces has been undertaken in accordance with
Council requirements. A summary of parking requirements in Noosa is shown in Table
6 below.
Table 6 ‐ Summary of Noosa Council Parking Requirements
Based on the requirement of Council the school requires a total of 168 spaces for the
College and 14 spaces for the childcare, as shown in Table 7, plus provision for set
down and buses.
Table 7 ‐ Summary of Council Requirements
Type of Use No. Required Spaces Total
Child Care 7 Staff 3.5 + 10.5 14
School Employee 130 Staff 130 130
School Students 1140 Students 38 38
Page 15
Page 16
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Reference has been made to the Department of Transport and Main Roads (TMR)
document Planning for Safe Infrastructure around Schools to provide further
information on parking requirements. Requirements are shown in Table 8.
Table 8 ‐ Summary of TMR Parking Criteria
Type of Use TMR Suggested Parking Rates
Pick‐up / drop‐off (2 minutes) 20% of short term supply
Short Term Parking 1 space per 15 students
Long Term (Staff/Visitor) 0.7 spaces per staff
Pre‐prep and Early Years 1 space per 8 students
Based on TMR requirements the school requires 174 parking spaces with 15 spaces
for pick‐up and set down and provision for buses as shown in Table 9.
Table 9 ‐ Summary of TMR Requirements
Type of Use Requirements
Pick‐up / drop‐off (2 minutes) 15
Short Term Parking 76
Long Term (Staff/Visitor) 91
Pre‐prep and Early Years 7
The proposal masterplan includes 298 car parking spaces including:
17 spaces for pre‐prep / early years (including 1 PWD)
81 spaces for short term parking (including 1 PWD)
153 spaces for secure staff long term parking
47 spaces for mixed use and student parking
In addition to the 298 car parking spaces there are 16 spaces in the drop‐off and
pick‐up lane and queueing for a further 8 vehicles within the site.
Table 10 – Summary of Car Parking Requirements and Provision
Source Car Parking Requirements
Noosa Council Planning Scheme 168
TMR School Infrastructure Guidelines 174
Conditions Car Parking Provision
GSLC on‐site Provision in 2020 203
(prior to new staff car park)
GSLC on‐site Current Provision 257
(with new staff car park)
Master Plan Provision 298
Page 16
Page 17
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
The proposed number of car parking spaces provided for the College complies with
Council and TMR requirements. Staging improvements toward the masterplan
indicate incremental increases in car parking availability and overall compliance with
the parking requirements under current guidelines.
Figure 11 – Car Parking Areas with the Masterplan
6.2 Improvement to drop‐off and pick‐up arrangements
As shown in Figure 12, the drop off area was considerably shorter in 2020. In 2021 the
drop off and pick up arrangements were extended as a result of additional space
created from the relocation of staff parking areas to the new car park.
Page 17
Page 18
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Figure 12 ‐ Aerial view of drop off and pick‐up zone 2020
Comparative analysis from surveys data indicates the additional drop off and pick up
spaces as shown in Figure 13 improve traffic flow and reduce queues.
Figure 13 ‐ Aerial view of drop off and pick‐up zone 2022
Page 18
Page 19
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Whilst the pick‐up and drop off arrangements shown in Figure 13 are temporary, they
are considered suitable until the formal construction of the master planned car park
is completed, refer to Figure 14. The master planned arrangement provides 16 pick‐
up /drop off bays, plus queueing and 81 short term car parks (increased from 58), with
one way traffic flow within the site. There is also a significant improvement to
pedestrian safety and connectivity within this car park. It is recommended the
pedestrian crossings be raised platforms to further reduce vehicle speeds.
Figure 14 – Master Plan proposed drop off and pick up lane
Page 19
Page 20
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
7 NETWORK PERFORMANCE
The three major roundabouts surrounding Good Shepherd Lutheran College have
been analysed using Traffic Modelling software Sidra 9.0. Traffic flows for the peak
hours were surveyed on Tuesday 3rd May 2022 and results for the operational
performance of the intersections are provided within this report. Please note the
summary of results shown below is for the overall approach, specific information for
each movement is available in the electronic file.
7.1 Goodchap Street and Eumundi Road
The roundabout has been analysed for the peak hours and results are provided.
Figure 15 – Aerial of Goodchap Street & Eumundi Road Roundabout
Page 20
Page 21
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Figure 16 – AM Peak Flows 2022
Figure 17 – PM Peak Flows 2022
Page 21
Page 22
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Table 11 ‐ Traffic Analysis of Goodchap Street Roundabout 2022 Peak
Goodchap Street and Eumundi Road Roundabout Geometry
Peak Approach LOS DOS Delay (sec) Queue (m)
2022 Eumundi Road S A 0.605 5.7 42.0
AM GSLC Access A 0.236 9.5 9.1
Peak Eumundi Road n A 0.461 7.9 22.3
Goodchap Street D 0.913 45.9 150.7
2022 Eumundi Road S A 0.496 5.2 30.1
PM GSLC Access A 0.148 9.9 5.6
Peak Eumundi Road n A 0.520 7.9 27.6
Goodchap Street B 0.668 18.6 53.6
*LOS – Level of Service & DOS – Degree of Saturation
Page 22
Page 23
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
The existing traffic flows at the intersection indicate the intersection operates
adequately in the afternoon peak period but the Goodchap Street approach has
reached capacity in the morning peak period. The limit for acceptable operations and
practical capacity (degree of saturation) for a roundabout is 0.850 and analysis
indicates the intersection is currently operating with spare capacity in the afternoon
peak period.
Further analysis was undertaken for the school 15 minute afternoon peak period to
determine queues and delays at the Goodchap Street and Eumundi Road roundabout.
Figure 18 ‐ Peak Flows – 3:00 to 3:15pm
Page 23
Page 24
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Table 12 – Operational Performance for the PM 15 min Peak
Peak Approach LOS DOS Delay (sec) Queue (m)
2022 Eumundi Road S A 0.506 6.0 30.8
15 min GSLC Access B 0.334 10.2 13.3
PM Eumundi Road n A 0.492 7.8 24.8
Peak Goodchap Street B 0.686 19.4 57.1
Results indicate that the roundabout operates adequately in the critical afternoon
school 15 minute peak period.
7.2 Eumundi Road & Walter Hay Drive
The roundabout has been analysed for the peak hour and results are provided.
Figure 19 – Aerial of Eumundi Road & Walter Hay Drive Roundabout
Page 24
Page 25
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Figure 20 – AM Peak Flows 2022
Figure 21 – PM Peak Flows 2022
Page 25
Page 26
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Table 13 ‐ Traffic Analysis of Walter Hay Drive Roundabout 2022 Peak
Walter Hay Drive Roundabout Geometry
Peak Approach LOS DOS Delay (sec) Queue (m)
2022 Eumundi Road S B 0.779 11.6 61.5
AM Walter Hay Drive B 0.596 13.4 32.2
Peak Eumundi Road N A 0.572 7.5 38.4
Venture Drive B 0.574 16.8 27.2
2022 Eumundi Road S A 0.596 8.2 34.1
PM Walter Hay Drive B 0.527 13.5 26.6
Peak Eumundi Road N A 0.577 6.8 37.0
Venture Drive B 0.519 13.5 23.3
*LOS – Level of Service & DOS – Degree of Saturation
Page 26
Page 27
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
The results of analysis for the existing traffic flows at the intersection indicate the
intersection operates adequately in the morning and afternoon peak periods. The
limit for acceptable operations and practical capacity (degree of saturation) for a
roundabout is 0.850 and analysis indicates the intersection is currently operating with
spare capacity and acceptable queues and delays.
7.3 Walter Hay Drive & Eenie Creek Road
The roundabout has been analysed for the peak hour and results are provided.
Figure 22 – Aerial of Walter Hay Drive & Eenie Creek Road Roundabout
Please note the PM peak occurred between 3:00pm and 4:00pm for this roundabout,
however to maintain consistency flows for 2:30 to 3:30pm have been chosen for
school peak hour analysis.
Page 27
Page 28
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Figure 23 – AM Peak Flows 2022
Figure 24 – PM Peak Flows 2022
Page 28
Page 29
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Table 14 ‐ Traffic Analysis of Eenie Creek Road Roundabout 2022 Peak
Eenie Creek Road Roundabout Geometry
Peak Approach LOS DOS Delay (sec) Queue (m)
2022 Walter Hay Drive S B 0.736 11.1 52.4
AM Eenie Creek Road E A 0.466 5.5 29.8
Peak Walter Hay Drive N B 0.732 13.0 46.8
Eenie Creek Road W C 0.676 20.8 83.2
2022 Walter Hay Drive S A 0.563 8.9 32.1
PM Eenie Creek Road E A 0.568 6.9 41.3
Peak Walter Hay Drive N B 0.716 11.9 43.7
Eenie Creek Road W A 0.529 9.7 42.2
*LOS – Level of Service & DOS – Degree of Saturation
Page 29
Page 30
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
The results of analysis for the existing traffic flows at the intersection indicate the
intersection operates adequately in the morning and afternoon peak periods. The
limit for acceptable operations and practical capacity (degree of saturation) for a
roundabout is 0.850 and analysis indicates the intersection is currently operating with
spare capacity and acceptable queues and delays.
7.4 Summary of Network Conditions
The operational performance of the external road network during school morning and
afternoon peak hour conditions is acceptable and within current guidelines. The new
staff car park does not adversely impact the external roundabout operations. There is
no demonstrated requirement to provide an internal connection within the college to
alter the current distribution of traffic to the external road network. An internal
connection (other than for emergency) is also not supported due to conflicts with
student pedestrian movements and concerns around student safety. Analysis
indicates there is ample capacity within the road network, namely Walter Hay Drive
and the roundabouts to cater for any minor changes to school traffic behaviour
patterns as a result of trips associated with the new staff car park.
Page 30
Page 31
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
8 CONCLUSIONS & RECOMMENDATIONS
This report has reviewed the changes to access and parking demand since the
construction of the new staff car park on the corner of Eumundi Noosa Road and
Walter Hay Drive. A review of the road network has also been carried out to determine
the operational performance of the three roundabouts during the school morning and
afternoon peak hours.
The results of comparative analysis of survey data are provided below:
a) As expected, there was an increase in movements to and from Walter
Hay Drive due to the changes in accessing parking areas.
b) There was a decrease in vehicles entering from Eumundi Road (which may
be staff) and a slight increase in vehicles exiting in the morning peak. This
may suggest more families are dropping off in the morning peak period
rather than parking and exiting later.
c) There was a reduction in the number of bus movements throughout the
survey period with 27 buses entering and 24 exiting recorded throughout
the day in 2020 and 25 buses entering and 22 existing in 2022.
d) Vehicle queueing in the drop off/pick up area has significantly decreased
in 2022 compared to 2020. This is due to the improvements to an extended
pick up and drop off zone. This has mitigated any impact on the Eumundi
Road roundabout.
e) Peak parking demand has remained consistent in 2020 and 2022.
f) There are 153 available spaces in the new staff car park and the peak
occurred at 9:45am with 138 spaces occupied and 15 spaces available.
g) There is less demand for parking in Area A and B throughout the day in
2022 compared to 2020, indicating staff were previously parking all day
in these areas.
h) The current parking provision and the proposed master plan parking
provision is compliant with Council and TMR requirements for educational
establishments.
i) The external roundabouts operate adequately in the school peak periods
with spare capacity. The new staff car park does not adversely impact the
external roundabout operations. There is no demonstrated need to
provide an internal road connection within the college to alter the current
distribution of traffic to the external road network.
Page 31
Page 32
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
In summary the current arrangements and proposed master plan provides an
appropriate number of car parking spaces for staff, students and visitor parking. The
changes to the car parking areas have not adversely impacted on the operational
performance of the network. As such there is no demonstrated need for an internal
connection (other than for emergency access). The current temporary drop off and
pick up arrangements are a significant improvement to previous conditions and should
continue to operate with staff supervision and regular reviews. The proposed master
plan drop‐off and pick‐up is considered suitable and will provide further
improvements to the safety and efficiency of access and movement within the College.
Page 32
Page 33
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Appendix A
Traffic Survey Data
Provided by Austraffic
Page 33
Page 34
AUSTRAFFIC VIDEO PARKING OCCUPANCY SURVEY Site No. 1 Weather: Fine Location: | Good Shepherd Lutheran College, Noosaville Day/Date: — Tuesday, 3 May 2022 AM Occupancy Time Zone A Zone B Zone C Zone D Zone E Prep 7:30 AM 0 9 0 24 53 2 7:40 AM 2 13 0 25 63 3 7:50 AM 3 15 0 30 78 3 8:00 AM 4 12 0 29 99 5 8:10 AM 8 17 0 29 118 12 8:20 AM 11 30 0 30 131 18 8:30 AM 10 21 0 30 134 17 8:40 AM 5 14 0 30 134 11 8:50 AM 5 14 0 33 136 10 9:00 AM 5 18 0 36 137 7 9:15 AM 4 20 0 40 136 7 9:30 AM 3 19 0 43 137 3 9:45 AM 3 16 0 a1 138 2 10:00 AM 3 12 0 34 137 1 10:15 AM 3 8 0 30 137 1 10:30 AM 2 6 0 30 135 ) 10:45 AM 2 6 0 3t 132 1 11:00 AM 2 7 0 31 132 1 14:15 AM 2 6 0 32 131 1 11:30 AM 2 6 0 30 133 2 11:45 AM 2 5 0 31 134 0 12:00 PM 2 5 0 31 134 1 12:15 PM 2 6 0 35 133 1 12:30 PM 2 5 0 36 134 2 12:45 PM 2 4 0 37 131 1 4:00 PM 3 6 0 38 131 1 4:15 PM 3 5 0 37 129 0 4:30 PM 2 7 0 38 129 0 4:45 PM 2 7 0 38 128 0 2:00 PM 2 8 0 36 127 1 2:15 PM 4 10 0 36 127 4 2:30 PM 12 16 0 39 128 6 2:40 PM 12 33 0 44 130 4 2:50 PM 12 44 0 43 132 21 3:00 PM 12 48 0 49 132 19 3:10 PM 9 34 0 27 128 10 3:20 PM 9 18 0 20 115 12 3:30 PM 6 25 0 24 113 12 3:40 PM 10 20 0 25 103 8 3:50 PM 10 17 0 26 95 8 4:00 PM 11 20 0 27 88 9 4:15 PM 10 22 0 28 66 1 4:30 PM 8 24 0 27 53 3 Page | of 2
Page 35
Page 1 of 2 Eumundi Road (north) AUSTRAFFIC VIDEO TRAFFIC COUNT Weather: Fine 1 Site No.: Good Shepherd Lutheran College, Noosaville Day/Date: Tuesday, 3 May 2022 Location: Entry ———> Hour ending- 8:45 AM 3:45 PM AM Peak: PM Peak: Access (east) <— Exit Goodchap Street(west) Hour ending - Camera Position Eumundi Road (south) sspfg]o - CORK CTC FCC COCO OOO OOOO OOOO OOO OOO CO Oo Olg z lo 6 © = = 0 mis SERSRLSNXST Hem rr annnownwnovrno HE RVYssL EAs Soc 69s bee g ° ro Fe ee | Rd) 10 10 = 9° = ip sgoyenMnpaH]o - - COSCO NDC COC OO OOO OOOOH HK OH OH TCO CO Oo Ofg iz. lo senuss 5 SLSRLSLoe rT Loan t- annnonnoneol Rs SLES Slee 29S bee ssplg]o oO OK COC CC OOO OOO CC OO COC CC CO COO OCC OC Oo Of L lo < ¢e g < moulN RX 5Sl Lene Ror ne tener ent avwe tne mon 2SRZBAA Shosa Zaz logh B foyecogsesngto co COC OOOO OOOO OOOO OOOO OOO OOOO OOOO OO Og i) i) sgyayenMey]o or C0 CCFO K COCO OOO CC OO OOOOH CC OK CCC CO CO Oly L lo sHMeAMITE VLE BLL eew®or ner tnr rv trnvranro+ PS 8RgX & Soca 18z, logL gspo~g}o- CCC COD ODO DODO OOOO OOOO OOOO OOOO OOOO CO oO Off L 0 re molABSrrRPstrnrmannnonor ner tnnmarmm tS RSeRsgeaa tS Siosg 28% sph 2 E povowcapsesngyo oo CC COO COO OD OOOO OC OO OOO DOO OD OOOO OOO OD i) i) sgaya, MPBH]O - CSCC OC O HK OCOD ODD OD ODDO DOOD OH OOH OOOO OOo Oo Oly L i) =o seen MOR BEGET LB ANMmHaNNNTOH OK NK TH MNMTSORKESSRSRARE Ligo9 98Z, Sel s £ SSSSSSSESESEZ2Z2222222222 2222222222532 22228 wo e<etcecrcecececercc ec cctc¢ctcoaoaogaacaacaacaatcaaaaca 25 SbSHSHoHUoKHUSHLESRVSHYSHYSHASLGKnSoHoSHESOH OH OH 5 w SfIOLING eedNVY [HeedWd -F TSOuretTesereTeEeRURsFPSrErPlFrBEgguagser2rererenre+ere = RBeBBoKeSHKE HEHE SFESSCSCSOT TET AVNANNSFSPLPHE ANNAN KH HHH HS
Page 36
Page | of 2 Eumundi Road (north) AUSTRAFFIC VIDEO TRAFFIC COUNT T Weather: Fine 1 Good Shepherd Lutheran College, Noosaville Day/Date: Tuesday, 3 May 2022 Site No.: Location: Ente N @ camera Position . 8:30 AM 3:30 PM Hour ending - AM Peak: PM Peak: Water Hay Drive (east) Water Hay Drive (west) Hour ending - ‘Two-Way Totals ‘sy8149| revo 43, 65 59 7 10 24 29 23 "1 13 16 izzy ize seyoeeg 2 sesng] sz lor seaiyen AneoH| sey 146r] 42 7 10 22 ar 2 13 1 4 zee zee Exit S104 1204 seyoeog 3 sesng) saya, Arvony seyaiyen 146] Entry ‘SISIPAQ| rer0L 65 59 7 10 29 23 " 13 16 ‘seyovod 8 esng) Isz lov saaiyan Arey | s9oiye 14611} 24 42 60 56 7 8 6 7 5 0 2 2 1 4 3 2 3 4 4 3 2 4 2 2 1 1 2 7 10 22 ar 24 6 9 13 14 loee TIME (1/4 hr end) 7:45 AM 8:00 AM 8:15 AM 8:30 AM 8:45 AM 9:00 AM 9:15 AM 9:30 AM 9:45 AM 10:00 AM 10:15 AM 10:30 AM 10:45 AM 11:00 AM 14:15 AM 11:30 AM 11:45 AM 12:00 PM 12:15 PM 12:30 PM 12:45 PM 4:00 PM 4:15 PM 4:30 PM 4:45 PM 2:00 PM 2:15 PM 2:30 PM 2:45 PM 3:00 PM 3:15 PM 3:30 PM 3:45 PM 4:00 PM 4:15 PM 4:30 PM 1101 44 6 heed WY Heed Wd
Page 37
Page | of 2 Eumundi Road (north) AUSTRAFFIC VIDEO TRAFFIC COUNT a <e# a 2 5 g 8 Z os % 2 3 vo 2s 28 5 nea B35 e223 Es B22 ao aes 33 3 38 “068 2s gEz Zea os 5 zes Awa 8:45 AM 4:00 PM Hour ending - AM Peak: PM Peak: Water Hay Drive (east) Water Hay Drive (west) Hour ending - ‘Two-Way Totals ‘sy8149| revo 13 18 13 2 1 7 34 loz. lov bh seyoeeg 2 sesng] lon seaiyen AneoH| sey 146r] 32 45 16 12 37 2 7 3 leer Ivor. be Exit S104 1204 13 33 46 18 3 63 40 2 7 34 30 loz love Wh seyoeog 3 sesng) lov saya, Arvony seyaiyen 146] 32 45 16 12 56 37 2 7 31 30 leee. beb Entry ‘SISIPAQ| rer0L ‘seyovod 8 esng) saaiyan Arey | s9oiye 14611} 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TIME (1/4 hr end) 7:45 AM 8:00 AM 8:15 AM 8:30 AM 8:45 AM 9:00 AM 9:15 AM 9:30 AM 9:45 AM 10:00 AM 10:15 AM 10:30 AM 10:45 AM 11:00 AM 14:15 AM 11:30 AM 11:45 AM 12:00 PM 12:15 PM 12:30 PM 12:45 PM 4:00 PM 4:15 PM 4:30 PM 4:45 PM 2:00 PM 2:15 PM 2:30 PM 2:45 PM 3:00 PM 3:15 PM 3:30 PM 3:45 PM 4:00 PM 4:15 PM 4:30 PM 1101 44 6 heed WY Heed Wd
Page 38
AUSTRAFFIC VIDEO TRAFFIC COUNT 2 5 = = 3 = = & = Good Shepherd Lutheran College, Noosaville Day/Date: Tuesday, 3 May 2022 Locatio! 8:30 AM 3:45 PM Hour ending - AM Peak: PM Peak: Hour ending - polo ner ooo ooo Ne Hr oo NOK Kor ooo Hr ODD OM oH NO Om AlGy le et 2 $ |soyseogg songlann t+ 0c oC COCO ND HK COND H HP OHM COOH ODOC OM OHO Om Aly en oy 2 : @| sagen Men|o ooo CCC CCC CO DODD DDD OO Ol lo 0 2 seyenwe|-§ © OO OC OOD DCDCDC CCDC DD OOOO DODO C COCO C CON OO Of 1 iz poln- er eof CoC oro HP CoH oH CCC ooo Hr Coo Or OMe OK Ofzz ls ub i sewseogg seng|- - re COC oo or OH oor oreo ecco coc oro mo Oe Ole ' a 8|% aya 3 samen melo oo a ac acee cece eee ec Co eC HFC eFC OFC eFC eo C Oo eG Ol lo 0 3 a saya won} © OOO DCO D DDD OD CDC OD CODCOD OO COD OO oH OO Ol b b wol)- -m mec c ce eK DCC or Cor OH DDD CCC CONN AT ON lez le an seyeogpsesng])- - 99 CFCC CFO HF DDO OH OOP OH COCO DCD CONN NOON alee le 9 a saouan Meay]o 00 OCC OCC OCD DOOD OD CODCOD CODCOD COD OO CO Oly lo lo soya wor}o oc OOO OCOD FDC OCOD COCO oC OCD CoC OCD OOOH OO Ol lo L z SSE222222222 ws eee TT ETT TCE CTT CRRA RT ET ETE ETE REE ETE Zz SSESSSHSESSLSYSSLSYSLSLYsHsyssysysugsys & giirwiue peodwy |reodwd FS TSrexrser ese srssereVeregsgssers@ersere+yserersers = RSESESESESSSSELEEAAAN SEF SRSA K SESE PES
Page 39
AUSTRAFFIC VIDEO INTERSECTION COUNT
Eumundi Road (north)
Site No.: 1 Weather: Fine CameraPosition @| 1 2 3 4
Location: Goodchap Street/Eumundi Road, Noosaville 1 L
Day/Date: Tuesday, 3 May 2022 16 + cCH—s
AM Peak: = Hour ending- 9:00 AM 5—— . 6
ing Goodchap Street (west) Goodchap Street (cast)
PM Peak: Hour ending- 3:30 PM 4 + ——7
13 —pva . | —. F 8
2 1 10 9
Eumundi Road (south)
Movement 1 Movement 2 Movement 3 Movement 4 Movement 5 Movement 6 Movement 7 Movement 8
TIME
(1/4 hr end)
8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8
8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8
2 $ 2 $ 2 $ 2 $ 2 $ 2 $ 2 $ 2 3
sey tel ey sel eye tel eset elle eleletilel. tee,
= s g = s g = s g = s g = s g = s g = s g = s g
Size} sis ets ets si sts sitet sts st sts et st si sie
7:30 AM 1 0 1 8 0 8 97 3 | 100 | 9 0 9 0 0 0 7 0 7 4 0 4 16 0 16
7:45 AM 1 0 1 19 1 20 | 126 | 5 | 431 4 0 4 0 0 0 5 0 5 2 0 2 15 0 15
8:00 AM 2 1 3 16 0 16 | 136 | 4 | 140] 8 1 9 0 0 0 5 0 5 3 0 3 21 0 2
8:15 AM 0 0 0 10 0 to | 114] 4 | 118] 34 0 34 0 0 0 17 1 1a | 11 0 4 44 0 44
8:30 AM 1 0 1 22 0 22 | 133 | 3 | 136 | 38 0 38 0 0 0 33 0 33 | 12 0 12 | 72 0 72
8:45 AM 1 0 1 17 0 a7 | 131 3 | 134] 7 0 7 0 0 0 14 0 14 8 0 8 39 0 39
9:00 AM 3 0 3 13 0 13 | 157 | 2 | 159] 5 0 5 0 0 0 4 0 4 2 0 2 4 0 14
3 “reyze{-l2fe.* 7el2, 21° .° 1°12) 17171 1712). 12
e
=
g
= = = = z = a a z 5 z = z = = = = = z a = a S = =
8 8
a
=
<
Movement 1 Movement 2 Movement 3 Movement 4 Movement 5 Movement 6 Movement 7 Movement 8
TIME
(1/4 hr end)
8 8 8 8 8 8 g 8 g 8 g 8 g 8 g 8
3 8 3 8 3 8 3 8 3 8 3 8 3 8 3 8
= $ s $ s $ s $ s $ s $ s $ s 3
s/s} _]Fe]e}_]e)e}_] 2] e}_]} 28) 8} _} 28) 8). 72] es) 2] ey.
B/e]/s]s]e)]8]s)2]8)s) 2] 8] 8) 2] ]8)] 2] ] 8) 8] 8] 8) 8] 8
3 = & 3 = & 3 = & 3 = & 3 = & 3 = & 3 = & 3 = &
2:45 PM 0 0 0 15 0 15 | 186 | 4 | 190 | 12 0 12 0 0 0 2 0 2 1 0 1 1 1 2
3:00 PM 3 0 3 15 0 15 | 153 | 7 | 160 | 9 0 9 3 0 3 3 0 3 1 0 1 8 0 8
3:15 PM 2 0 2 18 0 18 | 169 | 6 | 175 | 13 0 13 0 0 0 29 0 2 | 14 0 4 60 0 60
3:30 PM 1 0 1 13 0 13 | 191 7 | 198 | 7 0 7 1 0 1 6 0 6 4 0 4 27 0 27
3:45 PM 2 0 2 18 0 1a | 1e7 | 3 | 199] 5 0 5 0 0 0 4 0 4 5 0 5 23 0 23
4:00 PM 1 0 1 16 1 a7 | 147 | 2 | 149] 4 0 4 0 0 0 5 0 5 0 0 0 8 0 8
4:15 PM 0 0 0 13 0 13 | 155 | 3 | 158] 5 0 5 0 0 0 3 0 3 4 0 4 14 0 14
z = er 3 = g 3 3 q z = a + = + F = a = = z = = 3
Fc = =
=
g
3 o = o = = = g z z = = = + = + = = = = = = = = >
a
=
a
AUSTRAFFIC VIDEO INTERSECTION COUNT
Site No.: 1
Weather: Fine
Location: Goodchap Street/Eumundi Road, Noosaville
Day/Date: Tuesday, 3 May 2022
Camera Position @
16 +
Eumundi Road (north)
1 2 3 4
AM Peak: — Hour ending - 9:00 AM 15 6
ing Goodchap Street (west) 7 Goodchap Street (cast)
PM Peak: Hour ending- 3:30 PM M4 —
13 —> | . € 8
12 i 10 9
Eumundi Road (south)
Movement 9 Movement 10 Movement 11 Movement 12 Movement 13 Movement 14 Movement 15 Movement 16
TIME
(1/4 hr end)
2 38 2 38 2 38 2 38 2 38 8 8 8 8 8 8
sz sg sz sg sz sg sz sg sz sg sz sg sz sg sz sg
s 3 & 3 & 3 & 3 & 3 & 3 & 3 & 3
SF} S}l728) 2} .7 28) a} .7 28) Se .78 | Spl. y es] ede] ey eye bay.
B/e]/s]s]e)]8]s)2]8)s) 2] 8] 8) 2] ]8)] 2] ] 8) 8] 8] 8) 8] 8
3 = 8 3 = 8 3 = 8 3 = 8 3 = 8 3 = 8 3 = 8 3 = 8
7:30 AM 1 0 1 1 0 1 94 4 98 89 6 95 0 0 0 90 0 90 9 0 9 16 0 16
7:45 AM 0 0 0 16 0 16 110 3 113 91 5 96 0 0 0 114 4 118 6 0 6 9 1 10
8:00 AM 5 0 5 23 0 23 122 4 126 120 2 122 0 0 0 170 2 172 7 0 7 10 0 10
8:15 AM 4 1 5 57 0 57 143 5 148 118 3 121 0 0 0 139 7 146 21 0 21 6 0 6
8:30 AM 4 0 4 55 0 55 156 4 160 134 2 136 1 1 2 121 2 123 16 0 16 16 0 16
8:45 AM 2 0 2 14 0 14 183 5 188 119 1 120 0 0 0 113 3 116 6 0 6 15 0 15
9:00 AM 3 0 3 1 0 1 215 7 222 138 2 140 0 0 0 118 3 121 1 0 1 22 0 22
zg 2=7-fafte{/crrelsts/ey2sysalaer-/-fclefsleyesisc°lseyel]-fs
5 & =
=
e
= SSS SES SS = sss
z 2 zs Bleflstlelé = e{/2lgstl? ¥/ 3 B
=
<
Movement 9 Movement 10 Movement 11 Movement 12 Movement 13 Movement 14 Movement 15 Movement 16
TIME
(1/4 hr end)
8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8
g 3 g 3 g 3 g 3 g 3 g 3 g 3 g 3
g| 8 | 3 | 3 | 3 | 3 | 3 | 3 | 3
$s Re $s Re $s Re $s Re $s Re $s Re $s Re $s Re
>] et]el2)2]aetli)2l]elizl2/]et]2)2]et12) 2a] ) 2a] els
53/3} ]8)3 } 878) 8) 878) 8) 8758) 8 | $78) 8] eye) §] se] eb] 8] 8
3 = s 3 = s 3 = s 3 = s 3 = s 3 = s 3 = s 3 = s
2:45 PM 6 0 6 23 0 23 150 2 152 138 1 139 0 0 0 140 5 145 5 0 5 15 0 15
3:00 PM 4 1 5 19 0 19 163 5 168 104 7 111 0 0 0 106 4 110 3 0 3 14 0 14
3:15 PM 5 0 5 30 0 30 144 1 145 103 4 107 0 0 0 117 4 121 8 0 8 15 0 15
3:30 PM 7 0 7 28 0 28 146 4 150 140 7 147 2 0 2 101 0 101 4 0 4 20 0 20
3:45 PM 1 0 1 1 0 1 144 6 147 162 3 165 0 0 0 95 4 99 4 0 4 13 0 13,
4:00 PM 5 1 6 12 0 12 152 2 154 134 3 137 0 0 0 135 5 140 4 0 4 10 0 10
4:15 PM 7 0 7 8 0 8 148 2 150 142 3 145 0 0 0 126 3 129 4 0 4 13 0 13,
= SSS So OT TST TS Sp TTS
3 8 s | 2 2/2 /8 [s/s | &]/ 8 gs; 8 [3g] e [3 2
e € =
=
e
=z SST SS Se ste =
z N x | s s/e);2lzele lela z#/2/s|s = | = =
=
E
Page | of 2
Page 40
Page 1 of 2 = £ s & 3 3 s x 3 2 3 g 5 a AUSTRAFFIC VIDEO INTERSECTION COUNT Weather: Fine Eumundi Road/Walter Hay Drive/Venture Drive, Noosaville 2 Day/Date: Tuesda Site No.: ry, 3 May 2022 Hour ending - AM Peak: PM Peak Walter Hay Drive (east) Venture Drive (west) 9:00 AM 3:30 PM Hour ending - 10 et Eumundi Road (south) 12 Camera Position @| ol]~ @ Zo No Neg lov rmoy2 55 SS © Slee as sepiyan AnwoH}o oe OO eH |g Is sejayan AneoH]} oO Oe OO Off Gf sapien Ys] ~ © No o m ZF leg ise seoyen yo] 2 = = LE © Shee us mul= & 5 LR R R/rer jor reijo o 22 XS Fhe ise sopiyan Away] - © oO - ~ Off lz, sejayan Area] NO MH NH OO |e Is sepyer wee SN RR Ror 86 se1yan YET] ~ > oo Y 2 Sez ee mulS 288 8 Ss BIsis fore rule § 8 8 3 Bs Slers Loe ze wt S$ = sopiyen Aeon Oo NN ON OIL a sejayen Anco] Wo wo + wo oo |ez, vb Som § = sepyer HS & & NR NX B KR |sev coe seer Hee B&B B B LIozs 29z 3 a 3 5 mouj= 2A 2k Iso 9s rojo 2S Sn mo + Fes Ly ae -g sopiyan MweoH}o o - Oo ~ oO Oz Gf sejayan AneoH]} oO HH OO |e lz, | s separa yor} = = G&L Rm leo iss saiyen WBT]o 2S 2 © m + Sos 6c moul2 3 8 8 8 B Blocs loze roul2 & 5 8 LS Bfico use sopiyen AneoH]- 9 om Oo NH IE or sojyen AneoH} 10 wo oN Nt [oz vb seomonuott 8 8 8 8 8 Bles ove semen uor|S & Sse Ss Slo jege zteaegesag gsree2eeer 3 mole 3S 8 8 8 Shen iy roe © § F FS | leon erg 5 5 3 sopiyen Away] 1 9 © WN © oO |9z lot sojyan AneoH] + © © nN o © + |9¢ ez Zz ¥ 2 2222288 ergexsesge E separ won| FB 8B S BS S |roz sz separ wo = YF FB L|eser s62 A 2 e 5 Zz 2 wmulR FAFA s loz ley rol’ 2% 88 8 Slr Isc = 28 oO me oO zo P gS sopyan MnwoHy}o - Oo - OO w|e lz, sejyen Area} -— - 0 0 Oo - wy lz, B Ze Sa & S> sepuen WER A S = SB NK |eoz be seer MeN 2 A RN A Sour 6 3 ar QB Ba % za 5 ao moulo eae ea oly i potlo ao - = - o ely te gz eo zZ 8 3 ga separ MneoH]o 0 0 0 0 Oo ofp lo seyan Aneoy]o 0 0 0 oO Oo ofp lo a smn a 2 5 a3 > 2 sepiyen yoo - om wm Nol IL seven yoo - = - Oo + ]oL bb o 18s = oe z 5 & . wg 2 2 +s es wé 2222222 w 5 eiiiize ~ $85 2 S86 SH Ss w oO fPIOLsussL peed WY 2& © So © S O S w/IFIOLIYSZ'L peed Wd a z=eAa Fs Se 2.ers zs Fe ZSrezsseer a s > = Rk BS SBSS = A666 8 34 4 282 << “a ARA Walter Hay Drive (east) Venture Drive (west) Hour ending - 9:00 AM AM Peak: PM Peak 3:30 PM Hour ending - 10 Eumundi Road (south) wojS eo SRA R Rev izoL wouil2 5 8 8 & B S |ooz ALL 2 2 sejayan AneoH] WO Oo eH mm oO AB 9 sopiyan MeoH]o NH OC Ow |g le separ uo] 2 °2 XR QA Q Roser 96 separ us) 2 RS BLS Rhroz IrLb roujS 25 28 S Sls joo mole FSF 22 Rl joo 2 2 sejayan AneoH] -— N - 0 0 0 Off o sopiyan Mey] - 0 0 0 0 oO Of Gf soar uo] = 2 RSA LS Shror 09 sepyer yor) 2 = SF 2S eS Klow 6s rouj2~n An S Shs ss woul &§& 2k = Seer lez = = sojaiyen AneoH] — — — Nw NOL a sopiyan Mey] Oo OH Ow |g le seer yo] = © © Zo = Che bs sepyern ws) 2 R QL RS Le loz pw}- © © © © © off lo pojjo oor Co Kl L 2 2 sejayan Area] 0 OS 0 0 © ofp o sopiyan Mea] 0 0 0 0 oO Of9 o seen yBr}- 2 2 0 oO © off o sepyerwB]o o oe oo Ke f roles 3&8 FH Suz Zeb wouj2 & & RF SA Asse Ize a a sejayan Area} oo - NO Ow |g lz, sopiyan Keay] Oo NH OH Og Is soar uo] = 8 A RF SB Booz sey sepyerws= A QS Alon ze 22323 Q5 e5se2e2e858 . woulS 8 8 8 8 Q Bes 186 . rou) 2 8 3 3 & Slow loze sejayan kava] oo 9 © om + + [ez ab sopiyan Mreoy]- NO NO wo [ez Ist wornust2 8 BRRkLrB worue|§ 88888 sepyenwiny = 8 SF BE Son 96 sopyerw6n|§ SS SF S Seon lsos wos 2 3 BFR Shoe yh wmouyN & & 2 2 S Neer lea e e sejayan AneoH} oo - Ot HH OlL 9 sopiyan Meo] - - Oo - OO ly le sequen ws = 3 Fee Lez beh sepyerwsS YRS 2 S RIser joe mus 5 RRS R So v6 wmuyS SR 22S Re lor o o sejayan AneoH] - Oo ON HH [9 Is sopiyen Meo] NO 0 0 Oo Ofg lz, square N & RQ 2S Sor 68 sepuenwsS & RSS A Rio zor s s § SSe2228 § 2222222 we <ezciizée we aittaaaiae Ze 2886 8 © gflBoLsusz) peed WH Zr 6 8 6 S Bg w /lOL4USZL peed Nd rs Rf Sssa5 Ss Fs SsSS53 8
Page 41
AUSTRAFFIC VIDEO INTERSECTION COUNT
Walter Hay Drive (north)
SiteNo: 3 Weather: Fine ror oa 4
Location: Walter Hay Drive/Eenie Creek Road, Noosaville Jododot y
Day/Date: Tuesday, 3 May 2022 16 7 Gs y
AM Peak: Hour ending- 9:00 AM s— 6
i Eenie Creek Road (west) $ @ Eente Creek Road (eas
PM Peak: Hour ending- 4:00 PM “4 + —71@ (easy)
Bo * - 8
conan roo
2 ou m9
Walter Hay Drive (south)
Movement 1 Movement 2 Movement 2 Movement 4 Movement 8 Movement 6 Movement 7 Movement @
re
(wu heen)
=| 2|2 z | z | Pl) e]e]2}/3}e}]2]B]e] 2] 2 z |
S/ ele fle fle gle}elele}etelelslele fle
Taam 0 | 0 | @ o | 2 | @ of] }opttes |e ||) | 2 |e
rasan | o | o | 0 1 | 0 a|s]ufe2fafo]o fo ffs | afro] 2 |ur} rm] co | ao
eoom | o | o | 0 fs fo ]s fs fs] afar] o]o fo] ao | a] vs] 2 |r} a | « | os
essa | o | o | 0 o fe ]om]e2 falas] s fo] 2] o | 2] | o |e] rs] o | | wo] « | 16
swat | o | o | of} w]o |] afs juts | o fos] + | os] a | 2 |} um] ec jae] o] s | os
casa | o | o fo ffs fw fa fs fas fs | 2 fe] sr fo | s ] er | 2 |e} ve] w | se] os | |
som | o | o fo} wl o lala | olw]s| ofa] + |ols{ oa] 2 |e fim] o || o | 2 | oo
z F elal=/alsl=la 5 elel*/elelsls
7 a w/e e/a z e/e]*]/efal la
&
Movement 1 ovement Movement 2 Movement 4 Movement 8 Movement 6 Movement 7 Movement @
rme
(1 heen)
zl Es |e |e Ple];=e}el]e}=e]e}e}=e)e]3 |e
512 /e8 ele ele elel|s/elel[s/e/elslile ele
zap fo | o |e | [1 | 2 ]|e@]s fs pe?s]of}s]ayo | a |) |e a | 08
acoru | o | o fo | «Jo fa] sf a fasta] + fa] 2] o]a]a fs asf] s | os a | 10:
asseu | o | o | o | «Jo | wu] sf 2 | sf] o fw] s | oo] s]s fs | se] rs] « | so] se] « | 2
awru | o | o fo | wo) 2 | a] fa fart | 2 fa] o]o]a]au fs fafa] o | ss] sr] 7 | oe
auspu | o | o | o | | 2 |] fs fafa] o fa] 2 fo fa] a | o fata] © | so] a | s | o
sor | o | o | o |] o | w] ss fo fafa] + fafa fo fa] f 2 | afr] s | sr] roo] 2 | 06
assem | o | o |e |r lo |r| x2| ola] a|o fasts |o ls |r|: | wf] m| 7 || oo | | o
7th) leler ers) (el) lel ele eel le
peter? ele ele) ee) ee lee eee
é
Walter Hay Drive (north)
SiteNo: 3 Lor oa 4
Location: Walter Hay Drive/Benie Cre osaville todiodo-
Tuesday, 3 May 2022 1 oe =
Hour ending- 9:00AM s— se
id Eenie Creek Road (west) $ @ Eenie Creek Road (east)
PM Peak: Hour ending 4:00 PM M4 +
— . —s
camera Position | fi!
2 ou m9
Walter Hay Drive (south)
Movement 9 Movement 10 Movement 11 Movement 12 Movement 12 Movement 14 Movement 18 Movement 16
rme
(whens)
=| 2] e]se]/2]2 z | 2 Pl) e]e]2]}/R}e}]2]B] se] 2] 2
Sle lel] ile i |e g ee ee ee
vam [0 | o | @ | os | 7 | wa | wo | 0 | 08 4 ofe]«}opwpe |] «|e |e p>: |
rasa | o | o | o | a | 2 |e | w | « | ce ° o | o | x2] o | a2 }uw] o fae] |] s | a
eoom | o | o | o | w]e |r] os fs | ef] 2 o fo] fs |} we] o fos] v | 2 |
essa | o | o | o | wa) a | wae] os | 2 | | a | 2 o | a] wf « | fm] 2 fom] ofr |e
esoan | o | o | o | we) 1 | ws] of + far] wo] o o | o | 2 | o | 2} | 1 | | as}: | 2
casa | o | o | o | we] a | wr] x | a | ss |r| s o | o | x | 2 | ar] am] « | am] as} s | a
som | o | o | o | wo] 7 | we] m | 2 | | m| 2 o fo | x2 | 2 | aw] wl « | os] x | 2 | a
z {-y°lorel®lelss?l@lele -r=rel=/el/e/*felel?|é
7 e[ eyes eles ee z eyey*]e|® 5
&
Movement 9 Movement 10 Movement 11 Movement 12 Movement 12 Movement 14 Movement 18 Movement 16
re
(wu heen)
elle] =e]e]e : Plate; e]e]=/e)al=e]e}2 |e
Si|lel|slile i ele] sl|ilel|s/eletsi|ile fle
zara | 0 |o |e | |e | ao 4 + pw] a yo] + |=} 2 [se | ver | ar | oe + pas
acoru | o | o | o | mw] 4 | wo] w | a s |e] of of ofc | + | ss] io] s | ue] 2 | 2 |
aspu | o | o | o fm] 2 || a fafa] sx] o fs] of o]o] xz + | mfr] + jas] 0] o | 2
aworu | o | o | o | sa] 2 || ef « |e] a | + | | of o | o] m |] + | as] se] o | ass] 2 | o | 2
aaspu | o | o | o |e | 2 || | 2 fer fo | s foes] of o | of om] + |e} m| o | ss] a] 2 | a
sora | o | o | o | ww] a |] a | o far fm | 2 fr] of o | oes | 2 | er} wo] s | sme] a | 2 | a
assem | o | o | o |e [1 || «| 2 fo] | 2 || 2] o | 2 | om | 2 |} | 2 | mo | o | a
2 Tey > ye yey tyTey ere Tey eytyey ol yo yey yee] Feeley le
z =Te7s7syTeysrsrelstsl>let>)> > le) |2le)* ers) 1s
3 =] 2 75 g 3 2 a
Page 1 of 2
Page 42
19915 Traffic Engineering Report
Good Shepherd Lutheran College, Noosaville
March 2023
Appendix B
Master Plan
Page 34
Page 43
NOTE:
THE DESIGN OF THE CARPARK IS TO BE GENERALLY
IN ACCORDANCE WITH AS2890.1: OFF-STREET CAR
PARKING, AND BE DESIGNED TO INTEGRATE THE
SETDOWN AND SHORT TERM PARKING AREAS, AND
SK-11
OPERATE IN A ONE-WAY CONFIGURATION. FINAL
LAYOUT TO BE CONFIRMED.
CARPARK DESIGN
CHAPEL
ISLAND
THROUGH
49.
QUEU
50.
EING
LANE
51.
LANE
52. JOB:
1,
01
4
53.
GSL00
528
25.
TH
54.
RETAINING WALL - <1m HIGH RETAINING WALL - <1m HIGH 5,
10
PA
0 26. 01.
OT
DATE:
5,100
55.
FO
27.
27/2/2023
5,
56. 70
7 1. 70. 69
.
68
. 67. 66
.
65
. 6 4. 6 3. 62. 61. 60
. 59
. 58
. 57. 0
72. 1, 01.
50 28.
02.
0
5,700
02.
29.
81. 5,
70
0 03.
30.
1,500
80.
FOOTPATH 5,
10 04.
31. 03.
0
79.
5,700
05.
5,
78. 70
06. 0
48 . 47. 46 . 45. 44. 43. 42. 41 . 40. 39 . 38 . 37. 36 . 3 5. 34. 33. 32.
ANE
TH
77.
E
07. 1, 04.
PA
HL
LAN
50
5,100
OT
0
OUG
FO
OFF
76. 9,
17
TH
THR
0
F-
2,600
TPA
24. 23. 22. 21. 20. 19. 18. 17. 16. 1 5. 1 4. 1 3. 12. 11. 10. 09 08
F
75. . .
DRO
FOO
5,910 2, 6 05
00 2, .
5,700
HPE CENTRE 5,700 74.
50
0
17 SHORT ST SOUTHPORT QLD 4215 AUSTRALIA
3,
PO BOX 930 SOUTHPORT QLD 4215 AUSTRALIA
00
P +61 7 5532 2044 / ABN 35 071 453 257
0
1,500
73.
FOOTPATH
06
.
3,006 2,494 3,000
THROUGH LANE
07.
16. 15. 14. 13. 12. 11. 10. 09. 08.
DROFF - OFF LANE
[email protected]
FOOTPATH
BURLINGBROWN.COM
CARPARK DESIGN YR 5
MASTER PLAN SCALE 1:500@A3
N CLASSROOMS
_PRELIMINARY
ISSUE
0 5 10 15 25m NOT FOR
CONSTRUCTION
Good Shepherd Lutheran College
MASTER PLAN
ISSUE
DEMOUNTABLE
LOCATION: LOCATION_115 Eumundi Rd__Noosaville__QLD__4566. P6
Used in these records
Traffic Engineering Report.pdfRelated documentApplication case desk ↗
About this file
- File size
- 11.7 MB (very large file)
- File type
No other editions are linked here.
Original file
Log in to download the original file
The download may take a few minutes. On mobile data, it is best to wait for Wi-Fi.